If you have never been to see the Central Park Dance Skaters Association, you must go.
It has the feel and energy of an impromptu gathering worthy of the most soul filled, feel-good late seventies movie you have ever seen. It is located mid-park at the foot of the bandshell area, can enter the park at 72nd st.
The mixture of people is fantastic. old, young, white, brown, tan, pink, black, men, women, homeless, not-homeless, in style, out of style, so out of style they are in style. What I find mesmerizing to watch are the relationships that form while skating, it is obvious that not everyone knows each other well, but an unspoken camaraderie washes over the skaters as the disco tunes roll. A very in-shape young shirtless black man will be pirouetting the afternoon away with an old white woman in spandex and they are quite simply...having an absolute blast. Going around in circles, bopping as they roll.
New York at its finest.
click on title above for more info.
maybe I will edit this post later, these words have only dusted the surface of dance skaters charisma.
Sunday, April 30, 2006
Saturday, April 29, 2006
involuntary charm
it is always nice to know someone who doesnt know how great they are. i think that is part of what makes some people charming. people who are just slightly unaware of how great they seem to others.
i think even if you are the type to over-analyze yourself and every little thing you do or say, there is still this small section of you, that you have no control over. facial expressions, hand gestures (to some extent) posture, what you look like from the back, your gait, the sound of your voice, how much of your teeth show when you talk.
i cherish these small events and random imperfections:
a piece of clothing slightly out of place.
a strand of hair falling midsentence.
a smudge on their face.
the shape of the back of their head.
what they say when they didnt hear what was just said "sorry?" "what?" "repeat that?" "excuse me?"
carrying bags and not being aware of the space they take up.
not being aware of the space their body takes up.
how they look when they are asleep.
how their face contorts when they sneeze.
you can never really know the effect your own presence has, because you are never there when you are not there.
and i think charm requires some innocence, that might explain why it is so rare.
i think even if you are the type to over-analyze yourself and every little thing you do or say, there is still this small section of you, that you have no control over. facial expressions, hand gestures (to some extent) posture, what you look like from the back, your gait, the sound of your voice, how much of your teeth show when you talk.
i cherish these small events and random imperfections:
a piece of clothing slightly out of place.
a strand of hair falling midsentence.
a smudge on their face.
the shape of the back of their head.
what they say when they didnt hear what was just said "sorry?" "what?" "repeat that?" "excuse me?"
carrying bags and not being aware of the space they take up.
not being aware of the space their body takes up.
how they look when they are asleep.
how their face contorts when they sneeze.
you can never really know the effect your own presence has, because you are never there when you are not there.
and i think charm requires some innocence, that might explain why it is so rare.
Friday, April 28, 2006
morning glory
I am not a morning person. Maybe that is why the urge and struggle of the morning almost always seems funny to me when I think about it later in the day. There are so many grouchy moments that are totally unwarranted.
Thursday, April 27, 2006
glory days
Last week i received the invitation for my 10 year highschool reunion.
My first few weeks in highschool were palpably miserable. i would get a ride every morning from a friends mom. As i waited by our front door for her brown Buick clunker to pull up..i felt nauseous. i was nauseous because i desperately wanted to be cool and fit in and have people like me and to find people who i genuinely liked. but i had no idea how to go about doing this.
It seemed to me that people knew each other already, that is the only thing i could think of as to how they could be so comfortable with each other so fast. i was naive and didnt know about peoples different ways of coping with new situations. I didnt know how people make Armageddon instant best friends in the first week, only to realize that, much like instant mashed potatoes, they just arent as good as the slow and steadily cooked real things.
Anyway as highschool continued the nausea subsided and things got better, but they were never great.
I made some friends, but i never quite felt like our good times were innocent. Maybe I had some warped sense of things, being of the the Anne of Green Gables persuasion. Maybe the worst thing I ever wanted to do was get drunk off of raspberry cordial, but things were much worse than that.
My friends wanted to get drunk, that was the goal. and with the alcohol came what seemed like good times, but if i were sober i cant say that the jokes would move me. I remember dancing in bars at age 16, jumping up and down feeling the warm buzz from a kamikaze shot and thinking...so this is what fun is i guess? but as i look back i see only that we desperately wanted the times to be as good as the music made them out to be.
My first few weeks in highschool were palpably miserable. i would get a ride every morning from a friends mom. As i waited by our front door for her brown Buick clunker to pull up..i felt nauseous. i was nauseous because i desperately wanted to be cool and fit in and have people like me and to find people who i genuinely liked. but i had no idea how to go about doing this.
It seemed to me that people knew each other already, that is the only thing i could think of as to how they could be so comfortable with each other so fast. i was naive and didnt know about peoples different ways of coping with new situations. I didnt know how people make Armageddon instant best friends in the first week, only to realize that, much like instant mashed potatoes, they just arent as good as the slow and steadily cooked real things.
Anyway as highschool continued the nausea subsided and things got better, but they were never great.
I made some friends, but i never quite felt like our good times were innocent. Maybe I had some warped sense of things, being of the the Anne of Green Gables persuasion. Maybe the worst thing I ever wanted to do was get drunk off of raspberry cordial, but things were much worse than that.
My friends wanted to get drunk, that was the goal. and with the alcohol came what seemed like good times, but if i were sober i cant say that the jokes would move me. I remember dancing in bars at age 16, jumping up and down feeling the warm buzz from a kamikaze shot and thinking...so this is what fun is i guess? but as i look back i see only that we desperately wanted the times to be as good as the music made them out to be.
Wednesday, April 26, 2006
in loving memory of Rosa Parks
So I have started riding the bus. I hardly ever take the subway anymore. My New York is different now. I love staring out the window as the bus rides along central park on 5th ave, especially in the Spring. Also I see all the museums along 5th avenue. I am like a tourist who lives here, still in awe...but I pay taxes.
humans
I am always looking for a job that has a big picture, a greater goal that transcends the everyday and weaves a larger cloth. Also, I have always wanted a job where the greater goal is something that I believe in.
Tonight I was talking to my brother about how I am so happy that I do not have clients to deal with, that most of my problems now are technical issues in the lab and how liberating that is. But as I was speaking I realized that even though I do not deal directly with people as much, it is still humans that I am ultimately aiming to please.
Whatever contribution I have to this research and whatever contribution this research ultimately has to the world of science..is all focused on humans. Yes we are looking at other closely related species for clues, but they are only valuable to us because they are so genetically similar to Homo sapiens. So it is not that we have some general conservation angle, because we dont.
Then i thought..maybe a larger goal can have merit even though it is anthropocentric...why not?
I always think this about our place in this world: We are apes, just like Gorillas, Chimps, Orangutans, Bonobos and Gibbons. But we are able to acknowledge a hierarchy of these apes and their varying levels of sophistication so to speak. So cant we safely say we have won the ape contest, we are just smarter and better suited to our environment so then we are free to do to it whatever we wish. We would never stop an Orangutan from breaking tree branches to make a nest because it is harmful to the environment, we would just see it as part of the way that they survive. So this insane logic always brings me to the thought that maybe the way we use our environment is not really wrong or harmful, it is just what we think we need to do to survive...and isnt that what every organism is doing?
Tonight I was talking to my brother about how I am so happy that I do not have clients to deal with, that most of my problems now are technical issues in the lab and how liberating that is. But as I was speaking I realized that even though I do not deal directly with people as much, it is still humans that I am ultimately aiming to please.
Whatever contribution I have to this research and whatever contribution this research ultimately has to the world of science..is all focused on humans. Yes we are looking at other closely related species for clues, but they are only valuable to us because they are so genetically similar to Homo sapiens. So it is not that we have some general conservation angle, because we dont.
Then i thought..maybe a larger goal can have merit even though it is anthropocentric...why not?
I always think this about our place in this world: We are apes, just like Gorillas, Chimps, Orangutans, Bonobos and Gibbons. But we are able to acknowledge a hierarchy of these apes and their varying levels of sophistication so to speak. So cant we safely say we have won the ape contest, we are just smarter and better suited to our environment so then we are free to do to it whatever we wish. We would never stop an Orangutan from breaking tree branches to make a nest because it is harmful to the environment, we would just see it as part of the way that they survive. So this insane logic always brings me to the thought that maybe the way we use our environment is not really wrong or harmful, it is just what we think we need to do to survive...and isnt that what every organism is doing?
Tuesday, April 25, 2006
self
How do you separate your personal desires from what your parents want for you? What are we but responses to our parents issues? We either perpetuate their issues, rebel against them or turn them into something positive, or negative. But they are always there, hanging heavy like a soaking wet towel that never dries. Hopefully as time rolls on it becomes easier to distinguish ourselves from our parents shortcomings, but I dont think I believe that we can truly ever wriggle free.
potential energy
maybe there is no such thing as a person "having potential". it is just something we tell ourselves so we feel better when we are doing nothing.
if you are not doing it, then you are not doing it, how are we to know what potential you have to do it.
you can only say you "had potential" if it was put into action at some point. then in retrospect, you had potential, only then would we know.
if you are not doing it, then you are not doing it, how are we to know what potential you have to do it.
you can only say you "had potential" if it was put into action at some point. then in retrospect, you had potential, only then would we know.
Monday, April 24, 2006
garden song
There are wooden garden steps in sets of three, descending slowly down to the deepest part of the backyard. i spent countless days sitting on those steps staring at the sky. there is a tree in the neighbors yard that is a black locust. it creates a silhouette almost like an African acacia, so i would imagine that it was, and that the sun was setting on the serengeti and not in the suburbs. why i imagined i was anywhere else is now mysterious.
the grass is coarse and brown now, the ferns have expired, trees have left us because of disease but it is still essentially beautiful. i know that grass intimately, a cartwheel brings you close to it, your bare feet touch it, then each hand and you trust that it will ease any fall.
the white pine still stands regally on the side of the yard, creating its unique needle mulch in the space underneath it. its branches were like a ladder asking to be climbed. but once you did you could not stop and you were both amazingly proud and afraid when you reached the top. sap all over your hands.
i am not sure what will happen to their yard, it begs to be reborn and i hope that it is someday and that children play there again. it is the best place for a child to play and they will need no other companion.
this post was inspired by the npr song of the day. click on the title "garden song" for link.
the grass is coarse and brown now, the ferns have expired, trees have left us because of disease but it is still essentially beautiful. i know that grass intimately, a cartwheel brings you close to it, your bare feet touch it, then each hand and you trust that it will ease any fall.
the white pine still stands regally on the side of the yard, creating its unique needle mulch in the space underneath it. its branches were like a ladder asking to be climbed. but once you did you could not stop and you were both amazingly proud and afraid when you reached the top. sap all over your hands.
i am not sure what will happen to their yard, it begs to be reborn and i hope that it is someday and that children play there again. it is the best place for a child to play and they will need no other companion.
this post was inspired by the npr song of the day. click on the title "garden song" for link.
Sunday, April 23, 2006
Polyester bride
So, I all had to do was google "rent a wedding gown" and I found that it is indeed possible to rent a gown. But at that moment when I realized my idea had already been made a reality...it didn't seem like such a good idea anymore.
forgive me for this contradiction from my last entry but it just feels tacky to me to rent a wedding gown.
forgive me for this contradiction from my last entry but it just feels tacky to me to rent a wedding gown.
Saturday, April 22, 2006
brush off the flakes
my fiance and i were having a conversation about a friend who we love, but who always breaks plans and who never calls. I know "i bet you think this blog is about you, dont you dont you" well it isn't. This person is not internet savvy and will never find this blog. why we even have a friend who is not internet savvy is another story.
Joe made a statement that is so perfect and it may already be obvious to you, but I thought it needed to be solidified with words:
Flaky is a euphemism for inconsiderate.
People get off too easy being called flaky or 'flaking out" on a situation. few people are that "out to lunch" that they dont know who they are blowing off.
It may be that they are not addressing the situation because they have too much anxiety about it. But either way, anxiety or total disregard, both empty into the same river of baloney.
DISCLAIMER: we have all been flaky at some point, that is why we have a pretty good idea what lurks behind this ignorant mask.
Joe made a statement that is so perfect and it may already be obvious to you, but I thought it needed to be solidified with words:
Flaky is a euphemism for inconsiderate.
People get off too easy being called flaky or 'flaking out" on a situation. few people are that "out to lunch" that they dont know who they are blowing off.
It may be that they are not addressing the situation because they have too much anxiety about it. But either way, anxiety or total disregard, both empty into the same river of baloney.
DISCLAIMER: we have all been flaky at some point, that is why we have a pretty good idea what lurks behind this ignorant mask.
death of a saleswoman
After I left my graphic design job that I had for 5 years I was initially very sad. The people at east *** east **nd Street had served as my surrogate disfunctional family, I loved and hated them with equal fervor.
But as the weeks have passed I have realized that I am so immensely happy that there is no stress in my life caused by clients. There is no trying to convince anyone that your bullshit design is truth. No one calling in to speed things up.
I have always found the relationship with clients an extremely uncomfortable one. You are have to be so syrupy sweet, which I am not, you have to make things sound better than they are. You have to polish a turd and present it on a platter and hope they dont smell it. It seems like deception, especially if you dont believe in your product.
I am a bad liar and I consider that a good quality.
I am so happy that most of my troubles these days are caused by a bad lysis buffer or a mysterious contamination of pcr. I never have to talk to the buffer and act like everything is great...I just throw it out.
But as the weeks have passed I have realized that I am so immensely happy that there is no stress in my life caused by clients. There is no trying to convince anyone that your bullshit design is truth. No one calling in to speed things up.
I have always found the relationship with clients an extremely uncomfortable one. You are have to be so syrupy sweet, which I am not, you have to make things sound better than they are. You have to polish a turd and present it on a platter and hope they dont smell it. It seems like deception, especially if you dont believe in your product.
I am a bad liar and I consider that a good quality.
I am so happy that most of my troubles these days are caused by a bad lysis buffer or a mysterious contamination of pcr. I never have to talk to the buffer and act like everything is great...I just throw it out.
fly-by-night frock
Also, I thought of this idea, why doesn't someone start a store where you can rent wedding dresses, like costumes? or like tuxes for gods sake!
Then people could afford elaborate, expensive gowns and who cares if you could never save it in your dusty attic only for your daughter to tell you she does not like it when it comes time for her to be married.
Then people could afford elaborate, expensive gowns and who cares if you could never save it in your dusty attic only for your daughter to tell you she does not like it when it comes time for her to be married.
material metamorphosis
I didnt really realize that I had so much to write about fashion and clothing, I kind of surprised myself.
And...I left something out.
I sort of touched on the concept of fashion as mind opener. But I forgot to mention a favorite saying of mine that I developed when shopping with my sister in law, Alise.
You look at a piece of clothing or accessory and you are drawn to it but, it is a little too BLANK for you. It may be too crazy, loud or colorful or big or too funky. So you ask yourself "is this the me that I am, or is this the me that I WANT to be?"
This question serves two purposes: 1) When you realize that the item is the you that you want to be and not the you that you ARE, you may not buy it because it does not fit your lifestyle and you will never wear it. or 2) it is the you that you want to be, so you buy it in hopes of a transformation.
I have found that when you choose option 2, initially the item arrives home from the store and is the ugly duckling in your closet. You avoid it. You try it on in the morning only to chicken out and change right before you walk out the door.
But then that fateful day arrives when your inhibitions are down and you make it out the door with the item on and slowly as the day progresses, you become comfortable in your new skin, you are complemented at work, you catch a glance of your new funky self reflected in a window and you realize that this item is indeed a swan and suddenly... all of your other clothes are mere ducks.
then you are...you guessed it... one step closer to the you you want to be.
CAUTION: there is always a possibility that you will never wear this item and money will have been wasted on your delusion, so dont try this at home unless you think can handle the financial risk, or just save the receipts.
And...I left something out.
I sort of touched on the concept of fashion as mind opener. But I forgot to mention a favorite saying of mine that I developed when shopping with my sister in law, Alise.
You look at a piece of clothing or accessory and you are drawn to it but, it is a little too BLANK for you. It may be too crazy, loud or colorful or big or too funky. So you ask yourself "is this the me that I am, or is this the me that I WANT to be?"
This question serves two purposes: 1) When you realize that the item is the you that you want to be and not the you that you ARE, you may not buy it because it does not fit your lifestyle and you will never wear it. or 2) it is the you that you want to be, so you buy it in hopes of a transformation.
I have found that when you choose option 2, initially the item arrives home from the store and is the ugly duckling in your closet. You avoid it. You try it on in the morning only to chicken out and change right before you walk out the door.
But then that fateful day arrives when your inhibitions are down and you make it out the door with the item on and slowly as the day progresses, you become comfortable in your new skin, you are complemented at work, you catch a glance of your new funky self reflected in a window and you realize that this item is indeed a swan and suddenly... all of your other clothes are mere ducks.
then you are...you guessed it... one step closer to the you you want to be.
CAUTION: there is always a possibility that you will never wear this item and money will have been wasted on your delusion, so dont try this at home unless you think can handle the financial risk, or just save the receipts.
Friday, April 21, 2006
fashioning a philosophy on fashion
Firstly, I would like to mention a story that I read in The Art of Happiness by the Dali Lama on how he resists material temptation. He is in a store with bountiful, colorful, attractive items, be it food or clothing and (to adopt the very apt tag line of the grocery store Garden of Eden) there is temptation in every aisle. Something interests him, he approaches it, holds it in his hand and pauses for a moment and asks himself, "do i REALLY need it" and usually the answer is "no". He puts it down and moves on.
So, my first idea on fashion is that it is intensely frivolous and only the weak are hypnotized by its useless offerings. Most things are not needed and there are more important things to spend money and energy on.
BUT THEN why will a new raincoat from banana republic make me feel better after a terrible day, it shouldn't, but it does, maybe it is because I am weak. Maybe I know that only the weak give in to material goods because I am a weak myself. BUT when I have a great day and am feeling strong I have also been known to reward myself with clothing or shoes or jewelry.
and it feels good...period.
Which brings me to my next point, can you be a woman in our society, especially in Manhattan and be treated with respect if you are chronically dressed terribly. I think not. Which is why wearing nice things makes you feel nice, because you are also being treated nicely by others, it is a classic feedback mechanism.
On the topic of shoes. Lets not even mention comfort, because face it you know when you are wearing shoes for comfort, or wearing them for style and even though I have resisted this and toiled, tossed and turned... never the twain shall meet. or practically never.
On the corner of my block there is a bodega and during the warm months of the year about 10 to 15 Hispanic men stand outside drinking coronas and playing the radio. It is impossible to walk by unnoticed if you are a woman. BUT it is possible to cause less of a stir if...you guessed it...your shoes are flat. I always knew that heels were traditionally sexy, but this is such an obvious display of how men react to them. Now keep in mind these particular men love to react, they wait on that corner all day waiting to react to something, so it is not totally a diverse cross-section of men. Nevertheless, i have noticed that if i am wearing a loose dress, that is not traditionally sexy, but heels, inevitably a cat call will be heard on high.
So what is it about high heels, are they sexy because they elongate the legs? is that it? I have this theory, that is truly uncomfortable and terrible to think of but here goes: Are women more vulnerable if they are in heels, as in can they be pushed over and taken advantage of easier? as i said truly terrible, but i am sort of looking at it from a purely biological point of view i suppose. Males wanting to spread their genes at all costs.
But with all the above said i cannot say that i have struggled free from this noose made of twisted clothes and jewelry all hanging from one beautiful Italian green pump hooked to a rafter above. i think the opposite is true.
In fact I think the reason why i have given this so much thought is because i am drawn to clothing and appreciate fabrics and colors tremendously. i almost started to cry once in the basement of abc carpet and home because i was surrounded with such an amazing display of luxurious fabrics. my maternal grandmother worked for saks 5th avenue as a dress maker and my mother and her side of the family have a certain reverence for quality craftsmanship in fabrics and clothing. I feel the same, but dont totally have the income to live up to this legacy.
another is this, fashion evolves. Every season it is different. that is a coincidence because i also am evolving. with each new spring i must have at least 5 different ideas than i did last year at this time...so why not show it. Wanting to dress exactly the same year after year shows that you are in some way rigid in thoughts, actions and ideas.
so open up your closet and open up your mind!
I cannot separate myself from this clothing driven culture entirely and I dont think I really want to. Maybe the cloak of fashion fueled guilt is really what I have to shed. Nothing bad is going on when I buy clothes, it is just me taking care of myself.
So, my first idea on fashion is that it is intensely frivolous and only the weak are hypnotized by its useless offerings. Most things are not needed and there are more important things to spend money and energy on.
BUT THEN why will a new raincoat from banana republic make me feel better after a terrible day, it shouldn't, but it does, maybe it is because I am weak. Maybe I know that only the weak give in to material goods because I am a weak myself. BUT when I have a great day and am feeling strong I have also been known to reward myself with clothing or shoes or jewelry.
and it feels good...period.
Which brings me to my next point, can you be a woman in our society, especially in Manhattan and be treated with respect if you are chronically dressed terribly. I think not. Which is why wearing nice things makes you feel nice, because you are also being treated nicely by others, it is a classic feedback mechanism.
On the topic of shoes. Lets not even mention comfort, because face it you know when you are wearing shoes for comfort, or wearing them for style and even though I have resisted this and toiled, tossed and turned... never the twain shall meet. or practically never.
On the corner of my block there is a bodega and during the warm months of the year about 10 to 15 Hispanic men stand outside drinking coronas and playing the radio. It is impossible to walk by unnoticed if you are a woman. BUT it is possible to cause less of a stir if...you guessed it...your shoes are flat. I always knew that heels were traditionally sexy, but this is such an obvious display of how men react to them. Now keep in mind these particular men love to react, they wait on that corner all day waiting to react to something, so it is not totally a diverse cross-section of men. Nevertheless, i have noticed that if i am wearing a loose dress, that is not traditionally sexy, but heels, inevitably a cat call will be heard on high.
So what is it about high heels, are they sexy because they elongate the legs? is that it? I have this theory, that is truly uncomfortable and terrible to think of but here goes: Are women more vulnerable if they are in heels, as in can they be pushed over and taken advantage of easier? as i said truly terrible, but i am sort of looking at it from a purely biological point of view i suppose. Males wanting to spread their genes at all costs.
But with all the above said i cannot say that i have struggled free from this noose made of twisted clothes and jewelry all hanging from one beautiful Italian green pump hooked to a rafter above. i think the opposite is true.
In fact I think the reason why i have given this so much thought is because i am drawn to clothing and appreciate fabrics and colors tremendously. i almost started to cry once in the basement of abc carpet and home because i was surrounded with such an amazing display of luxurious fabrics. my maternal grandmother worked for saks 5th avenue as a dress maker and my mother and her side of the family have a certain reverence for quality craftsmanship in fabrics and clothing. I feel the same, but dont totally have the income to live up to this legacy.
another is this, fashion evolves. Every season it is different. that is a coincidence because i also am evolving. with each new spring i must have at least 5 different ideas than i did last year at this time...so why not show it. Wanting to dress exactly the same year after year shows that you are in some way rigid in thoughts, actions and ideas.
so open up your closet and open up your mind!
I cannot separate myself from this clothing driven culture entirely and I dont think I really want to. Maybe the cloak of fashion fueled guilt is really what I have to shed. Nothing bad is going on when I buy clothes, it is just me taking care of myself.
Wednesday, April 19, 2006
life imitates art
something occurred to me as I waited to check out at the food emporium and stood there slouching.
You know when you are making a sculpture or drawing of a person from life and your line or piece of clay deviates ever so slightly from what impression you wish to portray, the whole piece can be thrown off, the energy can be lost, the mood can deflate, the strength can dwindle.
So imagine what a little slouching can do, or what a little standing up straight has the ability to do.
You know when you are making a sculpture or drawing of a person from life and your line or piece of clay deviates ever so slightly from what impression you wish to portray, the whole piece can be thrown off, the energy can be lost, the mood can deflate, the strength can dwindle.
So imagine what a little slouching can do, or what a little standing up straight has the ability to do.
words I love
...but hardly ever find an opportunity to use in conversation.
cavalier
shenanigans
smithereens
nebulous
cavalier
shenanigans
smithereens
nebulous
misanthrope musings
Is it possible to have a wedding that is stress free?
I just got engaged and people are already annoying me with their expectations.
I just got engaged and people are already annoying me with their expectations.
I thought I knew you, what did I know.
You know that feeling when you have known someone for a few years and you have a certain way of interacting with them and on some level you are able to predict what they will respond to and you subconsciously tailor your conversation so. Its like you have established this silent protocol when it comes to this particular person. As the years pass and you get to "know" them better and better, your routine with them has the potential of becoming more and more limited as you think you narrow down what it is that really makes this person tick.
Then a completely new person traipses in the door with a smile and a shoeshine and evokes a unexpected positive reaction from this person who you thought you knew. They are suddenly using words you have never heard them say and speaking with emphasis about topics you never knew they knew.
And then I think to myself-why wasn't I more "BLANK" with this person, maybe they would have liked it and things could have been different between us.
Then a completely new person traipses in the door with a smile and a shoeshine and evokes a unexpected positive reaction from this person who you thought you knew. They are suddenly using words you have never heard them say and speaking with emphasis about topics you never knew they knew.
And then I think to myself-why wasn't I more "BLANK" with this person, maybe they would have liked it and things could have been different between us.
Tuesday, April 18, 2006
rubber
I had this idea yesterday while talking to someone about laptops. you know the protective rubber jackets that are made for ipods to protect them from scratching? they should make something like that for laptops, so they dont get dented or scratched, but so that you can still open them and use it while this covering is on. what do you think? would people use this? does it already exist?
sequence of events
So last week I set up about 40 samples and sent them out for DNA sequencing and they all came back looking like crap so my mind started racing in the afternoon and continued right into the night: what could it be, what did i do , how could i have screwed all of these up so badly? it must be the primers, i must have screwed up the dilution and it is probably because i am so chronically bad at math.
Then we found out they were going to be re-run by the sequencing facility, great I thought. Then we prematurely downloaded what we thought were the sequences re-run and they looked just as bad as the first time! ahhhh. I was convinced that today I would walk in and throw out all of those god awful primers that i screwed up so royally on.
Then when I got in this morning we realized that we had not downloaded the newly re-run sequences, but re-downloaded the ones from the first time. And these real 2nd time sequences looked so much better and my whole day did a 180 and things were instantly great.
It is so amazing and scary how much my emotional status hinges on this: agctagctcgatagctagctagatcgatatcgattttagcggggatcgactagc
Then we found out they were going to be re-run by the sequencing facility, great I thought. Then we prematurely downloaded what we thought were the sequences re-run and they looked just as bad as the first time! ahhhh. I was convinced that today I would walk in and throw out all of those god awful primers that i screwed up so royally on.
Then when I got in this morning we realized that we had not downloaded the newly re-run sequences, but re-downloaded the ones from the first time. And these real 2nd time sequences looked so much better and my whole day did a 180 and things were instantly great.
It is so amazing and scary how much my emotional status hinges on this: agctagctcgatagctagctagatcgatatcgattttagcggggatcgactagc
Saturday, April 15, 2006
body of christ
I had this insane thought the other day that wouldnt it be informative if the bones of Jesus were discovered, so much for rising from the dead body and soul. This discovery would puncture the foundation of Christianity.
It would be difficult to prove that it was indeed his body and probably even more difficult to get funding for this project.
2006 years ago is really not that long though as far as remains are concerned. Certainly it is a possibility that there is still viable DNA present.
Their are at least two problems with this thought: 1) What scientist would really be interesting in proving such a thing?
2) people who have the belief that either Jesus did rise from the dead or that he didnt are not basing their beliefs on evidence or lack therof, so how would evidence factor into the belief equation? would it really change their opinion at all.
It would be difficult to prove that it was indeed his body and probably even more difficult to get funding for this project.
2006 years ago is really not that long though as far as remains are concerned. Certainly it is a possibility that there is still viable DNA present.
Their are at least two problems with this thought: 1) What scientist would really be interesting in proving such a thing?
2) people who have the belief that either Jesus did rise from the dead or that he didnt are not basing their beliefs on evidence or lack therof, so how would evidence factor into the belief equation? would it really change their opinion at all.
Monday, April 10, 2006
bud
if i had to describe myself at this moment i would say that i am a budding scientist. the bud is tight, small and green, but changing every day.
I have never so profoundly felt the crippling anxiety that whatever resolutions and conclusions that are reached within the limits of a day in the lab, which either excite or confuse, are meaningless until they are put into the context of the past. It may be that science works this way in all respects, that whatever we know today is just a shred of what we will know in the future and this is exciting of course, but makes for a weird feeling at the moment in the present.
i dont know how to let myself feel about it, should i really get upset when something does not work or will i find out next year that that was not working for a very specific reason that was out of my control. and by the same logic, should i allow myself to be happy when something works, or will i find out next week that it was "working" because of an error.
i cant help but look back at myself last tuesday and think what i fool i was thinking all the things i did about the work that i was doing at that moment.
i guess that this is progress, if even on a very very minute scale. it just feels so different than any other job i have had.
I have never so profoundly felt the crippling anxiety that whatever resolutions and conclusions that are reached within the limits of a day in the lab, which either excite or confuse, are meaningless until they are put into the context of the past. It may be that science works this way in all respects, that whatever we know today is just a shred of what we will know in the future and this is exciting of course, but makes for a weird feeling at the moment in the present.
i dont know how to let myself feel about it, should i really get upset when something does not work or will i find out next year that that was not working for a very specific reason that was out of my control. and by the same logic, should i allow myself to be happy when something works, or will i find out next week that it was "working" because of an error.
i cant help but look back at myself last tuesday and think what i fool i was thinking all the things i did about the work that i was doing at that moment.
i guess that this is progress, if even on a very very minute scale. it just feels so different than any other job i have had.
Sunday, April 9, 2006
birthing a blog
I have wanted to create a blog for some time now, but I felt like I should streamline my ideas first into a perfect little perky clever nugget that soothes and excites as it goes down. since that has not happened, I figured I would just start to write.
I have some thoughts that have incubated for long enough and are now ready to grow.
I have some thoughts that have incubated for long enough and are now ready to grow.
Subscribe to:
Posts (Atom)
